Os08g0174700

Please input one-sentence summary here.

Annotated Information

Function

The gene Os08g0174700 encode a somatic embryogenesis（SERK-family）receptor-like protein kinase 1(OsSERK1).Functionally, OsSERK1 is the closest homolog of AtBAK1 in rice. Therefore, we named it as OsBAK1( BRI1-Associated receptor Kinase 1). The expression of OsBAK1changed important agricultural traits of rice such as plant height, leaf erectness, grain morphologic features, and disease resistance responses. A new rice variety with erect-leaf and normal reproduction can be generated simply by suppressing the expression level of OsBAK1.

Reduceing levels of OsBAK1 and decreasing sensitivity to BL will lead to semidwarfism in overall growth and result in abnormal growth patterns(Fig.1)

Fig.1The_unnormal_growth_condition_of_OsBAK1.(The outer appearance of OsBAK1RNAi line leaves (right) showing constitutive sickness compared with those of control plants (left) grown for two weeks. (from reference ).

, especially in leaf development(Fig.8)

Fig.8 Defective_leaf_development_of__OsBAK1_RNAi_plants.(A) Surface of leaves of an OsBAK1RNAi plants (right) and control plant (left) grown for four weeks.Pictures in the lower panel show higher magnification of the boxed region.White bars indicate 300 µm. (B) Internal structures of leaves of an OsBAK1RNAi #5 plant (right) and a wild-type plant (left) grown for five weeks. Leaves containing veins were transversely sectioned by hand and observed under a compound microscope. Bulliform cells shown in wild-type plants are marked with arrow heads. Bar indicates 500 µm.(from reference ).

. OsBAK1RNAi transgenic rice plants are defective in the development of bulliform cells in the leaf epidermal layer and increase expression level of pathogenesis related gene and enhance susceptibility to a rice blast-causing fungal pathogen, Magnaporthe oryzae (Fig.2)

Fig.2 Higher susceptibility to biotic stress of leaves of OsBAK1RNAi plants.(Extent of OsBAK1RNAi line (right) infection with Magnaporthe oryzae compared to wild-type plant (left) grown for 7 weeks. Enlarged leaf features of them are shown in the lower panel.)(from reference ).

. OsBAK1, play versatile roles in rice growth and development.

Expression

1.Expression of OsSERK1 and in various organs of rice

Using a set of OsSERK1 primers (K-1; 5’AT(CT)AT(ATC)CATCG(AT)GATGTCAA3’ and K6-2; 5’CCATCTTGGGGCGTTCTGTG3’, where nucleotides in parentheses are a mixture). Actin (RAc-1; 5’AACTGGGATGATATGGAGAA3’, RAc-2; 5’CCTCCAATCCAGACACTGTA3’) was used as an internal control. The result showed that OsSERK1 was expressed in all organs and calli examined with different levels.Expression of OsSERK1 was relatively strong in a 1 DAP flower which contained a very early embryo, a leaf blade and a shoot apex. A callus on a regeneration medium with both cytokinin and auxin did not show significant change of the level of the OsSERK1expression in comparison to a callus on a callus-inducing medium(Fig.3 ).

Fig.3 Expression of OsSERK1 and in various organs of rice(Poly(A)+RNAs isolated from the indicated organs were reversetranscribed and used as templates of the PCR. RT-PCR products were detected by Southern blot (OsSERK1) or ethidium bromide staining (actin). + and–indicate whether reverse transcriptase was add). (from reference ).

2.OsSERK genes were expressed in various organs but with some tissue specificity

The OsSERK1 promoter showed reporter gene activities in some specific tissues in a germinating seed, leaf and root, but not in a developing embryo. This promoter activity suggests that OsSERK1 may have roles in non-embryonic tissues rather than in the embryo.OsSERK1 might also be involved in signaling of or response to phytohormones in these tissues(Fig.4 ).

Fig.4 Tissue-specific_GUS_activities_in_the_OsSERK1-GUS_rice_plants((A) 1-day imbibed embryo of plant #7. (B) Lamina joint of plant #7. (C) Growing lateral roots of plant #7. (D) Developing embryo (10 DAP) of plant #7. (E) 1-day imbibed embryo of plant #23. (F) Lamina joint of plant #23. (G) Growing lateral roots of plant).(from reference ).

3.Rice SERKs are involved in BR signalling

Overexpress the OsSERK1 rice gene in a weak BRI1 mutant,bri1-5.The transgenic Arabidopsis lines ectopically expressing OsSERK1 partially rescued the defective phenotypes of bri1-5(Fig.9).

Fig.9 OsBAK1_rescue_partially_the_Arabidopsis_mutant_bri1-5.( (a) Phenotypes of bri1-5 and transgenic bri1-5,expressing OsSERK1 is shown, which were grown in soil for 3 weeks. (b) The phenotypesof longer petioles and larger leaves in transgenic Arabidopsis (a) are shown. ).(from reference ).

Compared to bri1-5, transgenic plants expressing OsSERK1 showed larger statures, longer petioles and earlier flowering phenotypes.The expression of CPD has been widely used as a molecular marker to detect the effectiveness of the BR signalling pathway . BRI1 mutants usually show higher CPD expression levels than that of wild-type plants. Compared to bri1-5, the transgenic lines expressing OsSERKs showed significantly decreased expression of CPD (Fig.10).

Fig.10 Real-time_PCR_analysed_theexpression_of_CPD_gene_in_transgenic_plants,_bri1-5_itself_and_wild-type_Ws-2.(from reference ).

These results indicated that OsSERKs, like AtBAK1, can partially rescue bri1-5 mutant phenotypes.Functionally, OsSERK1 is the closest homolog of AtBAK1 in rice. Therefore, we named it as OsBAK1.

4.The subcellular localization of OsBAK1 protein The OsBAK1 protein in onion epidermis cells is located at plasma membrane (Fig.5) 5.OsBAK1 interacts with OsBRI1 in vivo Full length OsBAK1,the extracellular domain (OsBAK1-ECD), the intracellular domain (OsBAK1-ICD), and a truncated intracellular domain (OsBAK1-ICDD)(Fig.11)

Evolution

Phylogenetic analysis and suppression of a weak Arabidopsis mutant bri1-5 indicated that OsBAK1 (Os08g0174700) is the closest relative of Arabidopsis BAK1(AtBAK1). Genetic, physiological, and biochemical analyses all suggest that the function of OsBAK1 is conserved with AtBAK1(Fig.6‎).

Fig.6 A_phylogenetic_tree_of_the_SERK_family_protein_kinases_drawn_on_the_basis_of_predicted_entire_amino_acid_sequences.(from reference ).

Phylogenetic analysis of SERK proteins in Arabidopsis and rice.

In order to search for AtBAK1 orthologs among the rice genes that were reported to be as OsSERKs or OsSERLs in the public database using the amino acid sequence of AtBAK1 as a query. It was difficult to determine which gene was an exact AtBAK1 ortholog, because many similar genes were identified. OsSERKs and OsBISERK1 cluster together, closer to each other than to any other AtSERKs based on amino acid sequence homology (Fig.7‎).

Fig.7 Phylogenetic_analysis_of_SERK_proteins_in_Arabidopsis_and_rice.(Amino acid sequences encoded by AtSERK1 (At1g71830),AtSERK2 (At1g34210), AtBAK1/AtSERK3 (At4g33430),AtSERK4/ BAK7/BKK1 (At2g13790), AtSERK5(At 2g13800) in Arabidopsis and OsSERK2(Os04g0457800),OsSERK3 (Os06g0225300), OsSERK4(Os02g0283800) in rice (Oryza) (from reference ).

References

Please input cited references here.