Os01g0274800

From RiceWiki
Revision as of 13:04, 28 May 2014 by 孙亚男 (talk | contribs) (Expression)
Jump to: navigation, search

Please input one-sentence summary here.

Annotated Information

Function

This genen was shown to encode an R2R3 MYB transcription factor that was expressed preferentially in the anther tapetal cells and in the sugar-transporting vascular tissues. In addition, CSA is a Member of the Family of R2R3 MYB transcription Factors and is associated in vivo and in vitro with the promoter of MST8.CSA Directly Regulates MST8 in Rice and MSTs have the ability to transport a variable range of monosaccharides across membrane barriers and have been shown to play an important role in assimilate supply for sink tissue development. Furthermore,CSA is a key transcriptional regulator for sugar partitioning in rice during male reproductive development.CSA Regulates Carbon Accumulation in the Anthersand is Required for Anther Development and Pollen Maturation.The control of sugar partitioning by CSA greatly affects male reproductive tissue development in rice[1].

Expression

the CSA gene is preferentially expressed in the vascular tissue and the tapetum of the anther, as well as in other sinks[2].the CSA transcripts were undetectable in stem and leaf, but detectable in root. In the sterile empty glume, which surrounds the rice flower, no CSA expression signal was observed. Strong expression of CSA was detected in the lemma and palea and weaker expression in the pistil and seed.CSA is likely expressed in the anther wall layers at the early stages.During later stages,as the tapetum degenerated, the expression of CSA is likely restricted in the anther vascular tissue.the CSA expression signals were observed in the tapetum and vascular tissue of anther connective tissue.In addition, detectableCSAexpression signals were observed in root vascular tissues.Therefore, the location of CSA expression is consistent with the hypothesis that this gene is associated with the sugar partitioning into the anther, a major sink organ in rice.[1]

Evolution

Please input evolution information here.

You can also add sub-section(s) at will.

Labs working on this gene

  1. School of Life Science and Biotechnology, Shanghai Jiao Tong University.
  2. Department of Horticulture, Michigan State University.
  3. State Key Laboratory of Genetic Engineering, Institute of Plant Biology, Center for Evolutionary Biology, School of Life Sciences, Fudan University
  4. Department of Biology, Huck Institutes of the Life Sciences, Pennsylvania State University, University Park
  5. Department of Plant Production, Faculty of Bioscience Engineering, University of Ghent

References

Cite error: Closing </ref> missing for <ref> tag

Structured Information

Gene Name

Os01g0274800

Description

Conserved hypothetical protein

Version

NM_001049255.1 GI:115435923 GeneID:4325181

Length

1665 bp

Definition

Oryza sativa Japonica Group Os01g0274800, complete gene.

Source

Oryza sativa Japonica Group

 ORGANISM  Oryza sativa Japonica Group
           Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
           Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
           clade; Ehrhartoideae; Oryzeae; Oryza.
Chromosome

Chromosome 1

Location

Chromosome 1:9566484..9568148

Sequence Coding Region

9566915..9567077,9567297..9567751

Expression

GEO Profiles:Os01g0274800

Genome Context

<gbrowseImage1> name=NC_008394:9566484..9568148 source=RiceChromosome01 preset=GeneLocation </gbrowseImage1>

Gene Structure

<gbrowseImage2> name=NC_008394:9566484..9568148 source=RiceChromosome01 preset=GeneLocation </gbrowseImage2>

Coding Sequence

<cdnaseq>ggtggttcaaccagctggacccgaggattaaccggagggcgttcacggaggaggaggaggagcggctcatggcggcgcaccgggcgtacggcaacaagtgggcgctcatcgcccgcctcttccccggccgcaccgacaacgccgtcaagaaccactggcacgtcctcatggcgcgccgccaccgcgagcagtccggcgccttccgccgccgcaagccttcctcctcctccgcctcccccgcccccgcccccgcgccgccgccgccgccgcagcccgtcgtcgcgctccaccaccaccaccaccggtactcgcagcagtacagcgggtacagcggcgccgccgagtccgacgagtcggcctccacctgcaccaccgacctctccctcagctccggcagcgccgcggccgccgccgccgccgccgcggcggcgaacatcccctgctgcttctaccagcgcggcggcgcccaagccaccaccgacagccacaccatccccttcttcgacttcctcggcgtcggcgcgacatgattaccggcgacgtcctccggtggtggtggtgtacaggaaggaaggaaggaaggaagcagccaagatcaagcgatcaaaaccaagctaa</cdnaseq>

Protein Sequence

<aaseq>GGSTSWTRGLTGGRSRRRRRSGSWRRTGRTATSGRSSPASSPAA PTTPSRTTGTSSWRAATASSPAPSAAASLPPPPPPPPPPPRRRRRRSPSSRSTTTTTG TRSSTAGTAAPPSPTSRPPPAPPTSPSAPAAPRPPPPPPRRRTSPAASTSAAAPKPPP TATPSPSSTSSASARHDYRRRPPVVVVYRKEGRKEAAKIKRSKPS</aaseq>

Gene Sequence

<dnaseqindica>1072..1234#398..852#catccatccattccagcatttcttgaagcttgctgtggatcagagaggatggctcacgagatgatgggtggcttcttcggccatccgccgccgccgcctgcgacggcggcggtgggtgaggaggaggacgaggtggtggaggagacggaggagggtggccatggcggaggagttcaggggaagctttgcgcgaggggacactggcggccggcggaggacgccaagctcaaggacctcgtcgcgcagtacggcccccagaactggaacctcatcgccgagaagctcgacggcagatcaggtaagagctcctccatggcggtgggtgcaatgcccaagaacgacgcgcattgaaggtgtttgtgatgggatggcatggcagggaagagctgcaggctgaggtggttcaaccagctggacccgaggattaaccggagggcgttcacggaggaggaggaggagcggctcatggcggcgcaccgggcgtacggcaacaagtgggcgctcatcgcccgcctcttccccggccgcaccgacaacgccgtcaagaaccactggcacgtcctcatggcgcgccgccaccgcgagcagtccggcgccttccgccgccgcaagccttcctcctcctccgcctcccccgcccccgcccccgcgccgccgccgccgccgcagcccgtcgtcgcgctccaccaccaccaccaccggtactcgcagcagtacagcgggtacagcggcgccgccgagtccgacgagtcggcctccacctgcaccaccgacctctccctcagctccggcagcgccgcggccgccgccgccgccgccgcggcggcgaacatcccctgctgcttctaccagagcacgccgcgcgcctcttcctcttccaccgccgcgtgccgcgcgcctcgcgtcgcggcggcggctgacacggtggcgttcttccccggtgcaggctacgacttcgccgccgccccgcacgccatggctcccgcggcggcgtccacgttcgcgccgagcgcgcgctccgccttctccgccccggcgggccgcggcgagccccccggcgccgtcgaccagcgcggcggcgcccaagccaccaccgacagccacaccatccccttcttcgacttcctcggcgtcggcgcgacatgattaccggcgacgtcctccggtggtggtggtgtacaggaaggaaggaaggaaggaagcagccaagatcaagcgatcaaaaccaagctaaggttagagttagccaagaacaagactaggacgaggaggaggaggaggaacaagacgtgctcgaagctcatcaatggcgttctcaaccaaacaagttttttctgctgctgctgctgctgcaagctagcttagattattcagatgaagaacaataagaagaagatgtagtactagtaaactagtaatggtgtgtgcgtttggaaatcaacaagcttccatgccatgccatgcctcctctgttcatcgatttcttttttttatctctctcctctgtatgaacaagtagaagaagaagaagaacaaattaatccattgctctcgcagatggatcagcaacatcaagcattgccgcattgtctctctctttgtgttcattgtccatgacgccaaagagaaaagaagaaaaattttcattgctctgttcttgaaatc</dnaseqindica>

External Link(s)

NCBI Gene:Os01g0274800, RefSeq:Os01g0274800

  1. 1.0 1.1 Cite error: Invalid <ref> tag; no text was provided for refs named ref1
  2. Cite error: Invalid <ref> tag; no text was provided for refs named ref2