Difference between revisions of "Os01g0110100"

From RiceWiki
Jump to: navigation, search
(Labs working on this gene)
(2 intermediate revisions by one other user not shown)
Line 15: Line 15:
==Labs working on this gene==
==Labs working on this gene==
Please input related labs here.
Please input related labs here.
1.National Institute of Agrobiological Sciences, Ibaraki 305-8602, Japan
1.National Institute of Agrobiological Sciences, Ibaraki 305-8602, Japan
2.Division of Genome and Biodiversity Research, National Institute of Agrobiological Sciences, Tsukuba, Ibaraki 305-8602, Japan
2.Division of Genome and Biodiversity Research, National Institute of Agrobiological Sciences, Tsukuba, Ibaraki 305-8602, Japan
3.Center for Information Biology and DNA Data Bank of Japan, National Institute of Genetics, Research Organization of Information and Systems, 1111 Yata, Mishima, Shizuoka 411-8540, Japan.
3.Center for Information Biology and DNA Data Bank of Japan, National Institute of Genetics, Research Organization of Information and Systems, 1111 Yata, Mishima, Shizuoka 411-8540, Japan.
Line 23: Line 26:
==Structured Information==
==Structured Information==
    [[Category:Genes]][[Category:Oryza Sativa Japonica Group]][[Category:Japonica Chromosome 1]]
GeneName = Os01g0110100|
Description = Conserved hypothetical protein|
Version = NM_001185200.1 GI:297719534 GeneID:9270401|
Length = 5643 bp|
Definition = Oryza sativa Japonica Group Os01g0110100, complete gene.|
Source = Oryza sativa Japonica Group
  ORGANISM  Oryza sativa Japonica Group
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
            clade; Ehrhartoideae; Oryzeae; Oryza.
Chromosome = [[:category:Japonica Chromosome 1|Chromosome 1]]|
AP = Chromosome 1:536712..542354|
CDS = 540732..540959|
GCID = <gbrowseImage1>
GSID = <gbrowseImage2>
CDNA = <cdnaseq>atgcaggtgcctatgctaagaagcctcgagtacgtcgcttgctactacatcagtggaagctacagaacacaggagtacggatactgcatcaacaccaagcatatcagagatttggcctatgcagtttccttcctgccctactactggagagccatgcaggtcaagccccttatgtccttcacaattctcaattttcaaccatgctctttcaataaaaaaagaaaatga</cdnaseq>|
DNA = <dnaseqindica>4021..4248#agcacacaacaatataattaattagcagctgcatgcgtattgctcgttaattaagttgatcatatagaattaaccatggtgaagttctcgaagcaatttgaagggcagcttgtccctgagtggaagcatgcctttgtggactatagcttgctcaagaaagatcttaagaggatgcagcatgattattctccccaagggaccataattaccacctcaacacctcatgatcatcatcagcagcagcaatcagttgcggcgccatcaagttataatttgtctcactgcaggctcctgttgcacaagctcccggcggccttctttggctccaataatgctgatcatgctggagccatacaagtaattgacagtaaatccttgtgctaccatttttatcagttttgcaattaagccatagccatgcatgtgtactgaatcttttgcatgtactgtgtgtgcacatatatatataaatggaaaataggtgcgccggagagtgggcaggggggaggtttacgagacggaggtgacgccggagatggagacgacggcggcgacggcggcgagggagttcttcgcgaggctggacgcgcagctgaacaaggtgaaccacttctacaaggccaaggaggaggagttcctccacagaggtcactccctccggaagcagatggacatactcctcgacctcaagtcgcggtcgtcgtcgtctctctccggccaccaccgcgccgccgccggcgacgacccctccatttcttcttcttccgccacctccggcgccggtgagctacctctctctttctctctctcctgtagtgaccatggttagtgggaagctggtggtgagagaggatggagatgagctagcaggtattgtcatgcacgtaggatcgcattcgcagcaactagcttagcttagcttaattacccaaccccatttcatttcatttcatttcatggtacgtatggtattggtacgtgcgtgagcagcttgcccgggaataatggaatatcctcccctgatcaattgtgtggatgtctttaatgacttgcgtttttgtctgcatttggcacgaccatcatatcaacctcaacatcctactttacttagtgtcgcatcctgtccctcctgataatacctggtatagtagtatttatatattcttctttttctaaagagtacttttgcataggtatatatgccgcgtacagttaacaccttgacaattacaagcatatataattgtgtaggtcgagtttaaaaaactatatatactttgaccaaactatcataaaactatatttaaataccaaattaatatatcacaaaaccatgcatggatttaatatgaagtatcataaaactacatatcgacttagtaatgaagttatcataaaactacatattttagagtttatatttctagcaatattattctgatggagttataaacatagtctaattttggtgataagcttaatgctaaacccttgtggcctttccatggtgtggtttagatatgtacttcctctttgttacatatcataatgttacatatcataagtcattttgattttttaagtcaaatttttttaagtttgatcccatagaaaaatataacaatattttcaactcaaaacaaagaaactatctaaatatgttcaatgttatatgtaatgaaactaatatgatgctataagtgttgctctatttttttttaaacttggtcaaatttaaaaagccaaaacaaattataatatgaaacagaatgagtactaactagtatgcgattagacattttctagtattcaaatttattgtattatgaaatatctaatatcatactaggtagtaacattttgaaaatgtgaagtagtttttctatactaaggtcaaagtatttgtatttttgcaaaagttactttatatatggagattcttttttatgtcaatgctatcccctcattaattcgagaagaataacatgcagatgacatccatacatgaatatatgccaaattatgacagctatctaaaataatggcatttattccctcatgcaaaaaaatctacagttctatatagttcactcaatattaattactgattttttttataaaaaaaactcaaaacagaggatgagtccacgaggtacgtgacgtcagcaacagacacggacgagagccaacacgaaaccgcggtgatgagagaccctgaagagctttcggctgagcagggtctagaagattctggaagcttgtcaaggcagagcctagggaggacagtgagcagctgccagaggaagaacctgaagatcaacatccccctgacgacgccatgcaggacaatctctgcactcaccgacctcctccgggacgatctcgtcagccagcccaagaacaaatgcgactctgacgccggcatcacgttcacgaccatcaacaagacgaagctccggcacgccgagaagatgatcaagggcgccttcatcgagctctacaaaggtcttggatacctcacaacctaccggtaatttaatcaactgctaatctgtcatcctctaggaaatccatgtgtgttcagttcagattcagaagttcagaactgtttgtgtgatgtgaaatgcatgcaggaacctgaacatgatggcgttcgtgaagatcctgaagaagttcgagaaggttagcgggaagcaggtgctgtccgtatacctcagggcggtggagagctcctacttcaacagctccggcgaggctctgaagctgatggacgaggtggaggacgtgttcgtcaggcacttcgccgccggcaacaggcgcaaggccatgaagtacctcaagcccacgcaacggaaggagtcacacactgtcacattcttcatcggtaaacccaaaacaagaatctgcatgcagtttccactttgcaatgacaatctttgtaccactctgaatgtatgtatatgcagggctcatgacgggatgcttcgtggcgctgttcttgggctactgcatcatggcgcacatcgccggaatgtacacgcagcggcgcgactccatctacatggagaccgtctaccctgttttcaggtacacgcatgtagactctgcattttctgaaattctgcgttgatcgaatactgtatctgaattctgacatgaatggcaatggataattttgcagcatgttcagcctaatgttcctgcacctgttcatgtacgggtgcaacatggtggcgtggaggaaggcccggatcaactacagcttcatcttcgagttcgcggccggaagagagctcaagtaccgggacgtcttcctcgtctgcaccgcatccatggccgtcatcgtcggcgtcatgttcgcgcacctctccctcgccgtcaggggattccacgcccaggccatccccggattcttgctcctggtgaactcttctttcttgctccctcctgtcagactgtcgtcagtgtcacactgtcactgtcaacaaggaaccaaattaagaacatgcttttcttgctcattggatggacacgttgatcttgagttgttctcctgcaactggatcgtttcagaatgagaataatcatagtagtaatggaatctgttggtgctgcatgtctgaatgtaggggttcctgctgctgctgttctgcccattcaacatggtgtatcgctccactcggtttcagttcctcaggatactgaggaacatcgttttctcaccactctacaaggtaccacagtacatcttttctttttttttcttttgctaatctcttcatggagaataatgttgccaaattagtccaaattactacatatgttcttatatatcatgatggtttctgaatgtctgcaggttgtaatggtagacttcttcatggcagatcagctctgcagccaggtactactgaatatgctctacttaaaccactcaatccatgtcctgcattcaactgaaacctgaaaaaacaatggggataaacagataattaactttctgaaagaacaaaataaaaaatgcaggtgcctatgctaagaagcctcgagtacgtcgcttgctactacatcagtggaagctacagaacacaggagtacggatactgcatcaacaccaagcatatcagagatttggcctatgcagtttccttcctgccctactactggagagccatgcaggtcaagccccttatgtccttcacaattctcaattttcaaccatgctctttcaataaaaaaagaaaatgaaccatgcaaattttatgttccatatatcagcagtttggaatacacatttattgataaaatggaataaacacacacacaaaacaaaatgcactctgttcagctgaaaagaaaaactctctgaacttcctgaatatttctgaactttctgaaaatgtttgtgtatgttaatcagtgtgcaagacggtggttcgatgagagcgacacgggccacctggtaaacctgggcaagtacgtctcggcgatgctcgccgccggcgccaaagtggcctacgagaaggacaggagccttggatcactctcactcctcgtcatcgtctccagctctgcaacaatgtatcagctctactgggactttgtcaaggactggggcttgctccagcccaactccaagaatccatggctgaggaatgacctcatccttaagagcaagtccatatactacttgtcaatggtatgcatgttcgtcagtctatccccattcagacaggtgtataagcacagccaaaacgagttcatttgcagtagttcagtacaagctgcacgctcaaacacacactgtccaatcgacaaacccgactctcaatctctcaatcacagatcatcgataatgctcaaccgatatccaacctactatttaaaccacactatagtattgaaatggaaacgcaatttgatctgaatttgcaatgaatctgttccggggagaagtgaaccaaacactcaagtgttgtctgaacttttgcagggtctgaaccttgtgctaaggcttgcatggctacaaaccgtgatccatccaaactttgggagtttggactccagggtcacttcattctttctagctgctctcgaggtgatccggagagggcattggaatttctataggtaactgaagtttcagagttctgaacaaccacttatcctaaaaaataaaacagaaaaagcagtagcaggatttaggcaagaaaaatgagatcctgagacctgtggcatatgcttctttttttttttatatcaggctggagaacgagcatctgaacaatgcaggcaaattcagggcggtaaaaacagttccgctgccttttcacgaagctgacgaggaggactgatacgtgctacacaactgctgaatgatcatctgaccaagtgaccatgactagatctaatacttgtttcctcaccactcaattttttttttcaaaagagaaagtctcaagaatggtggagagttcagttcagtgactaaaatactttcactgaaataccttcagggttcagccttcagggaatggcaattgtatgcaactgaagacagtgatccgttcctagatgcattaacatgtataaaatacgcatcgcagtatcgcaaatgacatgaggttacttttgtttggcacc</dnaseqindica>|
Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001185200.1 RefSeq:Os01g0110100]|
[[Category:Japonica mRNA]]
[[Category:Oryza Sativa Japonica Group]]
[[Category:Japonica Genes]]
[[Category:Japonica Chromosome 1]]
[[Category:Chromosome 1]]

Latest revision as of 04:29, 14 May 2015

Please input one-sentence summary here.

Annotated Information


Please input function information here.


Please input expression information here.


Please input evolution information here.

You can also add sub-section(s) at will.

Labs working on this gene

Please input related labs here.

1.National Institute of Agrobiological Sciences, Ibaraki 305-8602, Japan

2.Division of Genome and Biodiversity Research, National Institute of Agrobiological Sciences, Tsukuba, Ibaraki 305-8602, Japan

3.Center for Information Biology and DNA Data Bank of Japan, National Institute of Genetics, Research Organization of Information and Systems, 1111 Yata, Mishima, Shizuoka 411-8540, Japan.


Please input cited references here.

Structured Information