OrsajCp011

From RiceWiki
Revision as of 06:42, 24 May 2014 by 潘文波 (talk | contribs) (Created page with "{{Plastid| GeneName = OrsajCp0011 ORF91 | Description = ORF100| Version = GeneID:3131453| Length = 270 bp| Definition = Oryza sativa Japonica Group ''unnamed protein produc...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search

Please input one-sentence summary here.

Annotated Information

Function

Please input function information here.

Expression

Please input expression information here.

Evolution

Please input evolution information here.

You can also add sub-section(s) at will.

Labs working on this gene

Please input related labs here.

References

Please input cited references here.

Structured Information

Gene Name

OrsajCp0011 ORF91

Description

ORF100

Version

GeneID:3131453

Length

270 bp

Definition

Oryza sativa Japonica Group unnamed protein product; ORF91 , Plastid gene.

Source

Oryza sativa Japonica Group

 ORGANISM  Oryza sativa Japonica Group
           Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
           Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
           clade; Ehrhartoideae; Oryzeae; Oryza.
Chromosome

Plastid

Location

Plastid:14077..14346

Sequence Coding Region

14077..14346

Genome Context

<gbrowseImage3> name=NC_001320:14077..14346

Gene Structure

<gbrowseImage2> name=NC_001320:14077..14346

Protein Sequence

<aaseq> MVYGYGKSNM PHPNRKRKGT DTQYDYWEEL LVMVSGLYVL FCVFLVLFIF FDSFKQESNK

  LELSGKEEKK KLNGENRLSR DIQNLLYIK</aaseq>
Gene Sequence

<dnaseqindica>1..270#ATGGTATATGGATATGGAAAATCCAACATGCCCCATCCTAATAGGAAAAGGAAGGGAACAGATACCCAAT ATGATTATTGGGAAGAACTTTTGGTAATGGTCTCGGGCCTATATGTTCTTTTTTGTGTGTTCTTAGTTCT ATTCATCTTCTTTGATTCTTTTAAACAAGAATCTAATAAACTAGAATTGAGTGGAAAAGAAGAGAAGAAA AAGTTAAACGGAGAGAATCGACTAAGCAGAGACATTCAGAATCTTCTTTACATCAAGTAA</dnaseqindica>

External Link(s)

http://www.ncbi.nlm.nih.gov/gene/?term=OrsajCp011 NCBI Gene:OrsajCp011 ORF91