Difference between revisions of "Mat-r"

From RiceWiki
Jump to: navigation, search
(Created page with "{{Mitochondrion| GeneName = mat-r| Description = maturase-related protein| Version = GeneID:6450171| Length = 2037 bp| Definition = Oryza sativa Japonica Group ''mat-r'', Mito...")
 
 
(One intermediate revision by one other user not shown)
Line 1: Line 1:
{{Mitochondrion|
+
Please input one-sentence summary here.
GeneName = mat-r|
 
Description = maturase-related protein|
 
Version = GeneID:6450171|
 
Length = 2037 bp|
 
Definition = Oryza sativa Japonica Group ''mat-r'', Mitochondrion gene.|
 
Source = Oryza sativa Japonica Group
 
  
  ORGANISM  Oryza sativa Japonica Group
+
==Annotated Information==
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
+
===Function===
            Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
+
Please input function information here.
            clade; Ehrhartoideae; Oryzeae; Oryza.
+
 
|
+
===Expression===
Chromosome = [[:category:Japonica Mitochondrion|Mitochondrion]]|
+
Please input expression information here.
AP = Mitochondrion:315812..317848|
+
 
CDS = 315812..317848|
+
===Evolution===
GCID = <gbrowseImage1>
+
Please input evolution information here.
name=NC_011033:315812..317848
+
 
source=Rice_Japonica_Mitochondrion
+
You can also add sub-section(s) at will.
preset=GeneLocation
+
 
</gbrowseImage1>|
+
==Labs working on this gene==
GSID = <gbrowseImage2>
+
Please input related labs here.
name=NC_011033:315812..317848
+
 
source=Rice_Japonica_Mitochondrion
+
==References==
preset=GeneLocation
+
Please input cited references here.
</gbrowseImage2>|
+
 
AA = <aaseq>RKKEGSKFRPLTVVPPIEKIMKEAIRMVPESIYDPEFPDTSHFRSGRGCHSALRRIKEEWGTSRWFLEFDIRKCFHTIDRHRFISILKEEIDDSKFFYPTQKQFSAGRLVGGEKGPDSVPNSVLLSALLGNIYLHKLDQEIGRIRQKHEIPLVVKIRSVLLRIGRRIDDQEKYGKEAGFNAPQDNRALIVGRVKSIQRKATFHSLVSSWHTPPTSTPRRRGDQKTPFVFPPSAALAAFLNKPSSLLCAAFLIEAAGLTPRAEFNGREGFNKNLAMRDLLKYCKRRGLLIELGGEAILVIRSERGLARKLAPFKSHSLLIRICYARYADDLLLGIVGAVFLLIEIQKRITHFLQSGLNLWVGSAESTTIAARSTVEFLGTVIREVPPRTTPIQFLRELEKRLRVKHRIHITACHLRSAIHSKFRDLGYSIPIKELTKGMSGRGRLLDAVQLAETLGKNGLKSPQVSVLWGTVKHIRQRSRGIPLLHSSGQSKVPSGVQQAVSRSGMSVLKTKLYTPFGRKAAGEGRGHWAGSFSSEFPIQIEAPIKKILRRLRDRGLISRRRPRPIHVASLTNVSDRDIVNWSAGIAISPLSYYRCCDNLYQVRTIVNYQIRWSAIFTLAHKHKSSARNIIPKYPKDSNIVNQEGGKTLAEFPNSIELGKLGLGQDPNNDGALNYMFNK</aaseq>|
+
==Structured Information==
DNA = <dnaseqindica>1..2037#agaaagaaagaagggtcgaagtttagaccgctcacagtagttccacccatagaaaagatcatgaaagaggcgatcagaatggtacccgaatccatttacgatcccgagtttccagacacatcgcacttccgctcgggtcgaggctgccactcggccctcagacggatcaaagaagagtggggaacctctcgctggtttttggaattcgacatcaggaagtgttttcacaccatcgaccgacatcgattcatctcaatcttgaaggaagagatcgacgattccaagttcttttaccccactcagaaacagttttccgccggacgactcgtaggaggtgagaagggccctgactccgtcccaaacagtgtactactatcggccctactaggcaatatctacctacacaagctcgatcaggagatagggaggatccggcagaagcacgaaattcctcttgtagtgaaaatcagatcggttctattaagaataggtcgtcgtattgatgaccaagaaaagtatggaaaagaagcaggcttcaacgctccccaagacaacagagccctcatagtggggagggtaaagagcatccaacgcaaagcaacctttcattcccttgtttcgtcgtggcacaccccccccacaagcacccccaggcgaaggggagaccagaaaacgccttttgttttccccccttcagcggccctagccgccttccttaacaagccctcgagcctcctttgcgccgccttcctcatagaagccgctgggttgaccccgagggccgaattcaatggtagagaaggctttaataagaatttggccatgagagaccttcttaagtattgcaaaagaaggggcctgctgatagagctgggcggggaggcgatactagttatcaggtcagagagaggcctggcccgtaagctggccccctttaaaagccattccttattaataaggatttgttacgcgcgatatgccgacgacttactactgggaatcgtgggtgccgtatttcttctcatagaaatacaaaaacgtatcacccacttcctacaatccggcctgaacctttgggtgggctccgcagaatcaacaaccatagctgcacggagtacggtagaattcctcggtacggtcattcgggaagtccccccgaggacgactcccatacaattcttgcgagagctggagaagcgtctacgggtaaagcaccgtatccatataactgcctgccacctacgctccgccatccattccaagtttagggacctaggttatagtatccctatcaaagagctgacgaaggggatgagcggaagaggtcgtctactggacgcggttcaactagcggagactcttggaaaaaatggactaaaaagtccccaagttagcgtattatgggggaccgtcaagcacatccggcaaagatcaagggggatcccgttgttgcatagctcaggtcagagcaaggtgccatcaggcgttcaacaggcagtctcacgatcgggcatgagtgtcctgaagacaaaattgtatactccctttggtcggaaggcggcgggggaaggaagggggcactgggcgggatctttcagcagcgaattccccatacagatagaggcgcctatcaaaaagatactccgaaggcttcgggatcgaggtctcattagccgaagaagacccaggccaatccacgtggcctctttgaccaacgtcagcgacagagacatagtaaattggtccgcgggcatcgcgataagtcctctgtcctactacaggtgctgcgacaacctttaccaagtccgtaccattgtcaactaccagatccgctggtccgctatattcaccctagcccacaagcacaaatcttcggcgcggaatataatcccaaagtaccccaaagactcaaatatagtcaatcaagaaggtggtaagacccttgcggagttcccaaacagcatagagcttgggaagcttgggctcggtcaagatccgaacaacgacggagcactcaactacatgtttaataagtag</dnaseqindica>|
+
    [[Category:Genes]][[Category:Oryza Sativa Japonica Group]][[Category:Japonica Mitochondrion]]
}}
 
[[Category:Genes]]
 
[[Category:Japonica mRNA]]
 
[[Category:Oryza Sativa Japonica Group]]
 
[[Category:Japonica Genes]]
 
[[Category:Japonica Mitochondrion]]
 
[[Category:Mitochondrion]]
 

Latest revision as of 05:34, 15 May 2015

Please input one-sentence summary here.

Annotated Information

Function

Please input function information here.

Expression

Please input expression information here.

Evolution

Please input evolution information here.

You can also add sub-section(s) at will.

Labs working on this gene

Please input related labs here.

References

Please input cited references here.

Structured Information