CcmFc

From RiceWiki
Revision as of 14:15, 27 October 2012 by Xysj2012 (talk | contribs)
Jump to: navigation, search
Gene Name

ccmFc

Description

cytochrome c biogenesis Fc

Version

GeneID:6450169

Length

2312 bp

Definition

Oryza sativa Japonica Group ccmFc, Mitochondrion gene.

Source

Oryza sativa Japonica Group

 ORGANISM  Oryza sativa Japonica Group
           Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
           Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
           clade; Ehrhartoideae; Oryzeae; Oryza.
Chromosome

Mitochondrion

Location

Mitochondrion:330597..332908

Sequence Coding Region

330597..331345,332350..332908

Genome Context

<gbrowseImage1> name=NC_011033:330597..332908 source=Rice_Japonica_Mitochondrion preset=GeneLocation </gbrowseImage1>

Gene Structure
(RNA Editing)

<gbrowseImage2> name=NC_011033:330597..332908 source=Rice_Japonica_Mitochondrion preset=GeneLocation </gbrowseImage2>

Protein Sequence

<aaseq>MVQLQNFFFFITFMVVLCGTAAPVLLKWFVSRDVSTGASFFNGTIIPILISLFSFLVYLHSRKFIRSMDRAKSGVLVKASRPILLPDKIGRSSSARNALFCFVPVLHFFIIESMGDLSYLESFCGLLCLQFFCTLFSLPRDRSAKRERALRSKGQTLWPKGNEQQNDKMRCPGHPHIERRVEGFGPVAFPAPPLSSGACLGPPEIGLEALALPTSRLLMAVGHDYYKKVKMNLSISHGGVCIFMLGVLLSNTNKIQFTQRLPLGSELHMGKERCCLRGLDHLHGPTFHSICGNLMIYKPSPTSERFMFEHDESLRADLLPINFPASYENGKLEDFLHRWMKNHEHKNFRFSMFPERRYFFSIRETRSTTEVAIHTNLFTDLYALIGTGSSRTGGWYTTIMKLPFLFSIWIGFLLASLGGSRSLLRQLQKDKLHWN</aaseq>

Gene Sequence

<dnaseqindica>1..749#1754..2312#atggtccaactacagaacttcttctttttcattacttccatggtcgtgccccgtggcacggcagcacccgtactattgaaatggttcgtcagtagagatgttcccactggtgcctcttcttccaatggtactataattcctattcctatctctttattcccttttttggtctatctacattcaaggaaattcatacgctccatggacagagcaaaaagtggagtgttggtcaaagcaagccgccctattctattaccagacaaaatagggagaagctcatccgctagaaatgctttatttcgtttcgttcccgttcttcatttccttattatcgaatccatgggggacttgtcatatttagaatctttctgcggtctgctctgtttacaattctttcgtactctcttctctttaccacgcgataggtcagcgaagcgtgagcgggcgctccgaagtaaaggccaaacacttcggcctaaggggaatgagcaacaaaatgacaagatgaggtgccccgggcacccccatatagaaagaagggtcgaaggttttgggcctgtagctttccccgctcccccctcgtcgagtggtgcttgtttggggccacctgaaatcgggcttgaagctctcgccttaccaacgagccgactgctgatggctgttggtcacgactactacaaaaaagtgaagatgaatctttctatttcacatggaggagtgtgcatctttatgttgggtgttcttctgtcgtgcgacccgatggcttatgtgcgacctgtggcccacgcctcctattctatttgtttagggcgggcggcgtgaactctgattcgatccgggtattcaatcccgccgctgagatgctcagttgactccttaaccttgataggaagatggcttattccaaaattcgtgcataagggtaaggaactttggatgaattaatgcgaatgggtgtaagcctcgctgctcggaaacacccagtgctgaccacactgagagacacgaaagcgcaggtaatgccagttggcgaagtggcgttaagcatccctagcggtacgcaaagagaggtcgtgatgatatcatctacgtccgtaccgctcctcgtggagtagatcccgcatccaaccaacccttttttgaccagggaacgggagaattcccactaccgctggcaggccagccgggccgtgagcgcggtgggaacgggcttcccaaaaagcgagccccggcccgggtcagcatagaatgggggggacggccctaatgttgtgttggccgggttgcgggcggataaaagcggacgtggggactcgggtcggggcacagcgtaactaagataagagagccattccatttagggcgagacagaatgggcgggcacaagcggtctggtgtccgagccgattggtcagacgacgactaccgcacatattatattagccgcctatcccggaatggactgggatggaatagaaagaacgcgaagcaacaagcaagggatgagcgctttgttgctaaagcgcatacgttttcttgctgggtcggtttgttttttggggcaataagcttgcttcttcacaagcttatccccgcccctttcctgtccgtcccgaccggcagcagttgggtttccccatctctcctcagcttccccggtcttcggcccgagctgtatgaggcagaaactcgtcccacgtacggttcggaggccgagccccacccctgcaataatggtgcggcttaggtcaactaatacgaataagatacagttcactcaacgattgcctttgggttccgaactccatatggggaaggaacgttgttgtttgcgaggtctcgatcatttacatggacccacttctcattccatttgtgggaatttgatgatttataaaccgtccccaacgagcgaaaggttcatgtttgaacatgatgaatcacttcgtgccgacctgttgcccataaactttcctgcctcatatgagaatggaaaactggaagattttctgcatcggtggatgaagaatcacgaacataagaatttcaggtttagcatgttcccagaaagaagatactttttttccattcgagaaacgaggagcacgactgaagtggctatacatacaaatccatttacggatctatatgcttcgattggaactggaagttccagaactggcggctggtataccaccataatgaaattgccttttctttttagtattcggataggatttctgttggcttcatcggggggctcgcgtagtttgttacgtcaactccaaaaggataagttgcattggaatcga</dnaseqindica>

External Link(s)

NCBI Gene:ccmFc