Category:Genes
Please input one-sentence summary here.
Contents
Annotated Information
Function
Please input function information here.
Expression
Please input expression information here.
Evolution
Please input evolution information here.
You can also add sub-section(s) at will.
Labs working on this gene
Please input related labs here.
References
Please input cited references here.
Structured Information
Gene Name |
WEP Description = Version = Length = Definition = Source = ORGANISM Oryza sativa Japonica Group Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP clade; Ehrhartoideae; Oryzeae; Oryza. |
---|---|
Description |
{{{Description}}} |
Version |
{{{Version}}} |
Length |
{{{Length}}} |
Definition |
{{{Definition}}} |
Source |
{{{Source}}} |
Chromosome | |
Location |
Plastid:34210..35733 |
Sequence Coding Region |
34210..35733 |
Genome Context |
<gbrowseImage3> name=NC_001320:34210..35733 source=Rice_Japonica_Plastid preset=GeneLocation </gbrowseImage3> |
Gene Structure |
<gbrowseImage2> name=NC_001320:34210..35733 source=Rice_Japonica_Plastid preset=GeneLocation </gbrowseImage2> |
Protein Sequence |
<aaseq>MATLRVDEIHKILRERIEQYNRKVGIENIGRVVQVGDGIARIIGLGEIMSGELVEFAEGTRGIALNLESKNVGIVLMGDGLMIQEGSFVKATGRIAQIPVSEAYLGRVINALAKPIDGRGEIVASESRLIESPAPGIISRRSVYEPLQTGLIAIDSMIPIGRGQRELIIGDRQTGKTAVATDTILNQKGQDVICVYVAIGQRASSVAQVVTTFHEEGAMEYTIVVAEMADSPATLQYLAPYTGAALAEYFMYRERHTLIIYDDLSKQAQAYRQMSLLLRRPPGREAYPGDVFYLHSRLLERAAKLNSLLGEGSMTALPIVETQSGDVSAYIPTNVISITDGQIFLSADLFNAGIRPAINVGISVSRVGSAAQIKAMKQVAGKSKLELAQFAELQAFAQFASALDKTSQNQLARGRRLRELLKQSQANPLPVEEQIATIYIGTRGYLDSLEIGQVKKFLDELRKHLKDTKPQFQEIISSSKTFTEEAEILLKEAIQEQLERFSLQEQT</aaseq> |
Gene Sequence |
<dnaseqindica>1..1524#atggcaacccttcgagtcgacgaaattcataaaattctccgcgaacgtattgaacaatataatagaaaagtagggattgagaatatcggtcgcgtagttcaagtgggggatgggattgctcgtattataggtcttggtgaaataatgtcaggcgaattagtcgaatttgcagaagggactaggggtattgctctgaatttggaatccaaaaatgttgggattgtattaatgggcgatgggttgatgatacaagagggcagttttgtaaaagcaacaggaagaattgctcagatacccgtgagcgaggcttacttgggtcgtgttataaatgctctggctaaacctattgatgggagaggcgaaattgtagcttcggaatctcgcttaattgaatctcctgctccgggtataatttccaggcgttctgtatatgaaccccttcaaacggggcttattgctatcgattcgatgattcctattgggcgcggtcagcgagagttaattattggggacagacaaaccggcaaaacagcagtagctacagatacaattctcaatcaaaaagggcaagatgtaatatgtgtttatgtagctatcggtcaaagagcatcctccgtagctcaagtagtaactactttccatgaagagggggccatggaatacactattgtagtagctgaaatggcggattcccctgctacattacaatacctcgctccttatacgggagcagccctggctgagtattttatgtaccgcgaacggcatactttaataatttatgatgatctctccaaacaggcacaagcttatcgccaaatgtcccttctattaagaagaccccccggccgcgaagcttacccaggggatgttttttatttgcattcacgccttttagaaagagccgctaaattaaattctcttttaggggaaggaagtatgactgctttaccaatagttgagactcaatctggagacgtttccgcctatattcctactaatgtaatctccattacagatggacaaatattcttatccgcagatctattcaatgccggaattcggcctgctattaatgtgggtatttccgtttccagagtaggatccgcggctcaaattaaagccatgaaacaagtagctggcaaatcaaaattggaattagctcaattcgcggagttacaagcctttgcacaattcgcctctgctctcgataaaacaagtcagaatcaattggcaaggggccgacgattacgagaattgcttaaacaatcccaagcaaatcctcttccagtggaagagcagatagctactatttatatcggaacaagaggatatcttgattccttagaaattggacaggtaaagaaatttctggatgagttacgtaaacacctaaaagatactaaacctcaattccaagaaattatatcttctagcaagacattcaccgaggaagcggaaatccttttgaaggaagctattcaggaacaactcgaacggttttcccttcaggaacaaacataa</dnaseqindica> |
External Link(s) |
Pages in category "Genes"
The following 200 pages are in this category, out of 86,212 total.
(previous page) (next page)B
- BGIOSGA000001
- BGIOSGA000002
- BGIOSGA000003
- BGIOSGA000004
- BGIOSGA000005
- BGIOSGA000006
- BGIOSGA000007
- BGIOSGA000008
- BGIOSGA000009
- BGIOSGA000010
- BGIOSGA000011
- BGIOSGA000012
- BGIOSGA000013
- BGIOSGA000014
- BGIOSGA000015
- BGIOSGA000016
- BGIOSGA000017
- BGIOSGA000018
- BGIOSGA000019
- BGIOSGA000020
- BGIOSGA000021
- BGIOSGA000022
- BGIOSGA000023
- BGIOSGA000024
- BGIOSGA000025
- BGIOSGA000026
- BGIOSGA000027
- BGIOSGA000028
- BGIOSGA000029
- BGIOSGA000030
- BGIOSGA000031
- BGIOSGA000032
- BGIOSGA000033
- BGIOSGA000034
- BGIOSGA000035
- BGIOSGA000036
- BGIOSGA000037
- BGIOSGA000038
- BGIOSGA000039
- BGIOSGA000040
- BGIOSGA000041
- BGIOSGA000042
- BGIOSGA000043
- BGIOSGA000044
- BGIOSGA000045
- BGIOSGA000046
- BGIOSGA000047
- BGIOSGA000048
- BGIOSGA000049
- BGIOSGA000050
- BGIOSGA000051
- BGIOSGA000052
- BGIOSGA000053
- BGIOSGA000054
- BGIOSGA000055
- BGIOSGA000056
- BGIOSGA000057
- BGIOSGA000058
- BGIOSGA000059
- BGIOSGA000060
- BGIOSGA000061
- BGIOSGA000062
- BGIOSGA000063
- BGIOSGA000064
- BGIOSGA000065
- BGIOSGA000066
- BGIOSGA000067
- BGIOSGA000068
- BGIOSGA000069
- BGIOSGA000070
- BGIOSGA000071
- BGIOSGA000072
- BGIOSGA000073
- BGIOSGA000074
- BGIOSGA000075
- BGIOSGA000076
- BGIOSGA000077
- BGIOSGA000078
- BGIOSGA000079
- BGIOSGA000080
- BGIOSGA000081
- BGIOSGA000082
- BGIOSGA000083
- BGIOSGA000084
- BGIOSGA000085
- BGIOSGA000086
- BGIOSGA000087
- BGIOSGA000088
- BGIOSGA000089
- BGIOSGA000090
- BGIOSGA000091
- BGIOSGA000092
- BGIOSGA000093
- BGIOSGA000094
- BGIOSGA000095
- BGIOSGA000096
- BGIOSGA000097
- BGIOSGA000098
- BGIOSGA000099
- BGIOSGA000100
- BGIOSGA000101
- BGIOSGA000102
- BGIOSGA000103
- BGIOSGA000104
- BGIOSGA000105
- BGIOSGA000106
- BGIOSGA000107
- BGIOSGA000108
- BGIOSGA000109
- BGIOSGA000110
- BGIOSGA000111
- BGIOSGA000112
- BGIOSGA000113
- BGIOSGA000114
- BGIOSGA000115
- BGIOSGA000116
- BGIOSGA000117
- BGIOSGA000118
- BGIOSGA000119
- BGIOSGA000120
- BGIOSGA000121
- BGIOSGA000122
- BGIOSGA000123
- BGIOSGA000124
- BGIOSGA000125
- BGIOSGA000126
- BGIOSGA000127
- BGIOSGA000128
- BGIOSGA000129
- BGIOSGA000130
- BGIOSGA000131
- BGIOSGA000132
- BGIOSGA000133
- BGIOSGA000134
- BGIOSGA000135
- BGIOSGA000136
- BGIOSGA000137
- BGIOSGA000138
- BGIOSGA000139
- BGIOSGA000140
- BGIOSGA000141
- BGIOSGA000142
- BGIOSGA000143
- BGIOSGA000144
- BGIOSGA000145
- BGIOSGA000146
- BGIOSGA000147
- BGIOSGA000148
- BGIOSGA000149
- BGIOSGA000150
- BGIOSGA000151
- BGIOSGA000152
- BGIOSGA000153
- BGIOSGA000154
- BGIOSGA000155
- BGIOSGA000156
- BGIOSGA000157
- BGIOSGA000158
- BGIOSGA000159
- BGIOSGA000160
- BGIOSGA000161
- BGIOSGA000162
- BGIOSGA000163
- BGIOSGA000164
- BGIOSGA000165
- BGIOSGA000166
- BGIOSGA000167
- BGIOSGA000168
- BGIOSGA000169
- BGIOSGA000170
- BGIOSGA000171
- BGIOSGA000172
- BGIOSGA000173
- BGIOSGA000174
- BGIOSGA000175
- BGIOSGA000176
- BGIOSGA000177
- BGIOSGA000178
- BGIOSGA000179
- BGIOSGA000180
- BGIOSGA000181
- BGIOSGA000182
- BGIOSGA000183
- BGIOSGA000184
- BGIOSGA000185
- BGIOSGA000186
- BGIOSGA000187